Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13168E1
Clone ID IST13168E1
Vector VICTR74
Project tigm

Sequence tag IST13168E1HMF1
Sequence
AATGTATGTGAGTACACAGTAGCTGTCTTCANACACCCCAGAAGAGGGCATCTGATCCCATTACAGATGGTTGTGAGCCA
CCATGTGGTTGCTGANAATTGAACTCAGATCCTCTGGAANAGCAGTCAGTGCTCTTAACCACTGAGACACCTCTCCAGCC
CCTAGAGCAACAACTTTACAGAGATTTTTCTTGAAGGAGTTTTCCCCTTGGAATAAGGATGAGGAGGATCATGGCGCTTG
GGCAGGTGATGGAAACGGANAAGAACACTTGGAAGTGTCTGGTGGCAATTTGGCTTTTTCCGAGTTTTAAGGTTTGTTCC
TTTGTTGTTGTTATTGTTGTTGCTGTTGTTTTTACATTTTAGTTATGGAGAANCAGCAGCCAGATCCCTTCCCCGTGTCT
NANCTGTANACTTGACNACATTGTGATGACTGTAANNAACATTGAAGACNCCACCATGTTTNATTCCAAGATCCTGGGNA
TGGN
Sequence Type genomic DNA
Unitrap ID UNI13511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7592361..7592843 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]


Sequence tag IST13168E1BBF1
Sequence
AATGTATGTGAGTACACAGTAGCTGTCTTCANACACCCCANAANAGGGCATCTGATCCCATTACAGATGGTTGTGAGCCA
CCATGTGGTTGCTGANAATTGAACTCANATCCTCTGGAAGAGCACTGACTGCTCTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es