Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12836G9
Clone ID IST12836G9
Vector VICTR76
Project tigm

Sequence tag IST12836G9BBF1
Sequence
ATACATCTACATTTAAAATATCAAAGGGTGAAAAAACCTAATTGCCACAGTGTTCTTGGATTTCCTGGAACACATCTATG
GGCACCCAAAGTGCTGTTGGGCCTGGGTTAAGAAGCCCCGGCTTGGTAAGAGTACTGACTGCTCTTCCAAAGGTCCTGAG
TTCCAATCCCAGCAACCACATGGTAGCTCACAACCACCCGTAATGAGATCCGATGCCCTCTTCTGGTGCATCTGAAGCTA
CAGTGTACTTGTGTATAATAACAAATCTGACAGGAGCGAGCANAGGTCCTAAAAATTCAATTCCCCACAACCATATGAAG
GCTCACAACCATCTGAACAGCTACNGTGTACTCACGTACATAAAATAAATAAATAANTNAGTAANATCTTANNAGAAGAA
GAAGAAGAAGAAGANNANGANGAAGAN
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73012541..73012966 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]


Sequence tag IST12836G9HMF1
Sequence
ATACATCTACATTTAAAATATCAAAGGGTGAAAAAACCTAATTGCCACAGTGTTCTTGGATTTCCTGGAACACATCTATG
GGCACCCAAAGTGCTGTTGGGCCTGGGTTAAGAAGCCCCGGCTTGGTAAGAGTACTGACTGCTCTTCCAAAGGTCCTGAG
TTCCAATCCCAGCAACCACATGGTAGCTCACAACCNCCCGTAATGAGATCCGATGCCCTCTTCTGGTGCATCTGAAGCTA
CAGTGNNNNNGTGTANAATAACAAATCTGACAGGAGCGAGCAGAGGTCCTAAAAATTCAATTCCCCACAACCATATGAAG
GCTCACAACCNTCTGAACAGCTACAGTGTACTCACGTACATNNNATAAATAAATAAATAAGTAAAATCTTAGAAGAAGAN
NANNANGN
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73012541..73012939 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es