Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14197A12
Clone ID IST14197A12
Vector VICTR74
Project tigm

Sequence tag IST14197A12BBF1
Sequence
CAGAGGAATACAAACACAGAAGGTCTAACAGGAACCACCTGGGATAGAATTCATGGTTAACAACTGGGATCAAAAAGAGC
TCCACCTAAGGTCCACTTAATCTTAGAAGCCAGGGTCAAGGACTTCGTGCCCTTGCCATAGTTCCTATTTTAGTCTATTG
TATANTCCACCTTCCCCCTAGGCCATTGTAAATTCATATGTATGGGTGTAACTCAGCTATCTATAGTTCTAANTATCTAC
TCTGGTTCCTCCTTANGTCTCAAACGTCCTTCTTCCTANATGATGGTAAATTCCTGTGTANGGCNGTGACTNANCTTTTA
TTCNNAGTGATANTGTAATGCCNNANGCTATTCNGANTGTCNCTGANNANGCTACATTCTTACTGANTTCNNNNCNNNNG
GTCTNNNNNAGGACTTTCTNNGAAGTTNNANCACTGGTNAANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14197A12HMF2
Sequence
CAGAGGAATACAAACACAGAAGGTCTAACAGGAACCACCTGGGATAGAAN
Sequence Type genomic DNA
Unitrap ID UNI7587 UNI33555 UNI36153 UNI36154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 125657145..125657193 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036815 (Dpp10) NM_199021 dipeptidylpeptidase 10 Gene [Source:MGI (curated);Acc:Dpp10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 112669623..112669671 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20880609..20880657 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 50211941..50211989 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 88471522..88471570 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28371470..28371518 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022262 (Dnahc5) NM_133365 dynein, axonemal, heavy chain 5 Gene [Source:MGI Symbol;Acc:MGI:107718]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38168053..38168101 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022812 (Gsk3b) NM_019827 glycogen synthase kinase 3 beta Gene [Source:MGI (curated);Acc:Gsk3b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17633233..17633281 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 74547754..74547802 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25178874..25178922 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 60618166..60618214 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 26946981..26947029 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23577155..23577203 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13120150..13120198 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030385 (2900092C05Rik) NM_028434 RIKEN cDNA 2900092C05 gene Gene [Source:MGI Symbol;Acc:MGI:1920340]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 12869977..12870025 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5186487..5186535 49
NO GENE  

 
Come back to gene ENSMUSG00000030385


For any suggestions or comments, please send an email to unitrap@crg.es