Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11724D4
Clone ID IST11724D4
Vector VICTR76
Project tigm

Sequence tag IST11724D4BBF1
Sequence
CTTTCTCTCGAATCCCAGGAGCAAAGCGAAAACTGATTCATGAGGAAACACAGACAAAGCAGACN
Sequence Type genomic DNA
Unitrap ID UNI30609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 83058630..83058693 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079511 (Ccdc142) NM_001081266 coiled-coil domain containing 142 Gene [Source:MGI Symbol;Acc:MGI:3045292]

 
Come back to gene ENSMUSG00000079511


For any suggestions or comments, please send an email to unitrap@crg.es