Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10406A2
Clone ID IST10406A2
Vector VICTR76
Project tigm

Sequence tag IST10406A2HMR1
Sequence
TGGTTTATTGGACTTATATACAAGCTCATTGCATCTTTCTTGCTTATCCTATTTTACCGACAATGTATAATTAGAAGCC
Sequence Type genomic DNA
Unitrap ID UNI1043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76877456..76877534 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es