Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14380H2
Clone ID IST14380H2
Vector VICTR74
Project tigm

Sequence tag IST14380H2BBF1
Sequence
ACATGCCAAGGAGTATAGGAAGCTTAAGTTCAAGAAACCTGACTTTATGCCTGGATATGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28373502..28373566 65
NO GENE  


Sequence tag IST14380H2HMR1
Sequence
TGACTTGACCTGTAAGGGGCTGCAAGCTCTACATGAAGAAATACTACAGGAAGCTACTTCAGCTGAGAATGGCTTTGAAG
CAGCTGCCTCTGGAGACCAGGGCACAACAGGTGGCCTGAACCATCTCCATTCCTGGGACTCTGGTCAGTGGTCATTAAGC
CTTTGGTAACCTAGGACATTTCTGAAGGGAGTGTCCCACAANAANATTTGAACCTGGGAGTCTTTAAGATTGCTAGCAAT
GTCATAAACAGGATCTAGTGAACACCCACCAAGGATGGATGTTTGACTTCTAAACCTACANAAGTTGTTTGGGTGGTCAT
ACCTCATANTACCTGGGTAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI2895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28373566..28373909 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031490 (Eif4ebp1) NM_007918 eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267]


Sequence tag IST14380H2HMF1
Sequence
CATGCCNNGGAGTATAGGAAGCTTAAGTTCAAGAAACCTGACTTTATGCCTGGATATGAGATCTACTTTGCCNGACTCCT
AAAGATCTGGAAAGGCAAGGAAAAAAGCCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28373423..28373565 137
NO GENE  

 
Come back to gene ENSMUSG00000031490


For any suggestions or comments, please send an email to unitrap@crg.es