Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14648D9
Clone ID IST14648D9
Vector VICTR74
Project tigm

Sequence tag IST14648D9BBF1
Sequence
CATGTGGCCCCAGGTGTGGCTAGTCTGAACTGAATGACAGTTAAATTAATTTAAATACAGACAAATTTCAAGCCTTATTA
TGAACGAATGTAAACAACCTCATCAACAACGTTTATGTTGATTATATGATGAAGTGGCATGCTGTCAAATTACTAAAACT
AATTTAACTTAATTTGAAAAAAAGTTGGAGAACTTATTTCATGTTGTCAAAATTTACTAGAAAACTAAGGTNATCNANNC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157202673..157202907 233
 
EST/CDNA Est Name
  W80148.1


Sequence tag IST14648D9HMR1
Sequence
TGGATNNTGAGCACTGCATTGTGTGGCTCAGAGTTCCCTGGGGAGTGCACGGGATGGCAGTCTGTGACATCTGTGACAAC
CAATACCACAGTGCATTTGTCCCTTTAATGTTGGGGTGGCAAAAGGAANCCATTTGTANGTGCCTCAATAAAGAGGCAAA
GGGGGAGGATGACNCAAAGGCCTGATGGGGAGGGTGACCCTTGTNCTCNGGCTTN
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157202908..157203121 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es