Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14723E1
Clone ID IST14723E1
Vector VICTR76
Project tigm

Sequence tag IST14723E1HMF1
Sequence
TTAGGGAAGGGCCTTAGCCATTTACAGCCCCAGCTACCTGTTTCCACTTCCCAATTCAACAAAGCCACTGCCTCCTACTC
CTGCGGACTCAGGCTGAGGGGCTCCCTCCACCACACCTTCTCCACCATGACAGACTGAAATTCTCTTACATCATGAGCCA
CAGCAAACTGCTCCTGCTAAGTATTTTCGAAACAATGACGATTAAAGCAAATATATGGACCGCACTTTCTATTTTAATGT
GGNNATNTNNACAGAGAGTGCTTATCAGTAAAATCAGATTAGGATGTATCCATCTTCANAAGAAAACTGAAAAGTGAATA
TGGGTTCCATTTATTTCCTGCCNACAAATACAGAAAGACCTAAGAAAGCCCAGAACAGCCTCTCAAGTAGCTTCGGGAAA
CTGTTCCCAAAAGCAAGGCNNTNNTATNCNTATCCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109784330..109784763 408
 
EST/CDNA Est Name
  BE862318.1


Sequence tag IST14723E1BBF1
Sequence
TTAGGGAAGGGCCTTAGCCATTTACAGCCCCAGCTACCTGTTTCCACTTCCCAATTCAACAAAGCCACTGCCTCCTACTC
CTGCGGACTCAGGCTGAGGGGCTCCCTCCACCACACCTTCTCCACCATGACAGACTGAAATTCTCTTACATCATGAGCCA
CAGCAAACTGCTCCTGCTAAGTATTTTCGAAACAATGACGATTAAAGCAAATATATGGACCGCACTTTCTATTTTAATGT
GGCGATATCAACAGAGAGTGCTTATCAGTAAAATCAGATTAGGATGTATCCATCTTCAGAAGAAAACTGAAAAGTGAATA
TGGGTTCCATTTATTTCCTGCCNACNAATACAGAAAGACCTAAGAAAGCCCAGAACAGCCTNNNNNGTAGCTTCGGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109784367..109784763 383
 
EST/CDNA Est Name
  BE862318.1


Sequence tag IST14723E1HMR1
Sequence
CTAGCAGTCCACCGCCACTATTTAGCCTCCTCCTCTTCCTTCAGATTGTTCAACCTCCCCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI1452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109784761..109784824 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050199 (Lgr4) NM_172671 leucine-rich repeat-containing G protein-coupled receptor 4 Gene [Source:MGI (curated);Acc:Lgr4-002]

 
Come back to gene ENSMUSG00000050199


For any suggestions or comments, please send an email to unitrap@crg.es