Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14271E5
Clone ID IST14271E5
Vector VICTR74
Project tigm

Sequence tag IST14271E5BBF1
Sequence
ATAGTCAGATATGCATAACACCGCATCTCTTCTAGAGACAGTCATTTCCTGCCTTTCAAACCCAACGTTGTAAAAACCCT
GTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25698070..25698157 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


Sequence tag IST14271E5HMR1
Sequence
GTAAACAGCTGAGCAGCTGGGCTCCGTCTTGGCAGGGGAGCCCCAGCACAACCCAGCAGGACATCCCCAGCTCANCGGGG
CATTGTCCAAAGAAAAAGGGGGGTAAAAGCTGAGTAAACAAGAAAGGATGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117015462..117015596 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es