Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11385E12
Clone ID IST11385E12
Vector VICTR76
Project tigm

Sequence tag IST11385E12HMF1
Sequence
CTTATGTTACTGAAATTCCTTCTGTCTTTCANNGAAGCCTGGGTTGATTTTGGAAGCTGAGATACCATCTAGGCTCCTGG
GTACTCTANAAGCAGATGAGGCCTCACACTCCTTCCTGGTGCTTTCTCTGGGGCCTGGAGCCTGAGCACCCTCCTCCCTG
GCANAGCTCTGGAAACGTCAGATATCTTGTTANTATTCTCTCTCTTTTTTTTCTCTTTTTTTTCCTGTTTTTTCCCCTTA
ACTCCTCTTTCTCTCCTCCTCTTTTCCTCTCTNACTGNTTTATGANATAGGGTCTNAAGCTATGTACCNNNGGCNGGCCN
NAAAANTTTTGGGGGGAGAAGTANATTATTGAGACNGGGTCCCATGTGTATTCCTGGCTGGTTTGGAACTTCACATGTAN
AGCANGCGGNNTTGAGTTNATGACTNTCCATTCTCTGCACTTGCTTTGTGTTGTTGGNGCTGGGCTGANCAAACCTTGGG
CATGCCAGAAAANCTGTCCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11385E12BBF1
Sequence
CTTATGTTACTGAAATTCCTTCTGTCTTTCAGAGAAGCCTGGGTTGATTTTGGAAGCTGAGATACCATCTAGGCTCCTGG
GTACTCTANAAGCAGATGAGGCCTCACACTCCTTCCTGGTGCTTTCTCTGGGGCCTGGAGCCTGAGCACCCTCCTCCCTG
GCANAGCTCTGGAAACGTCAGATATCTTGTTANTATTCTCTCTCTTTTTTTTCTCTTTTTTTTCCTGTTTTTTCCCCTTA
ACTCCTCTTTCTCTCCTCCTNTTTNNCTNTNTNACTGNTTTATGANATAGGGTCTNAANCTATGTACCNNAGGCTGGCCT
NANAANTNNNGGGGGGAGAAGTANATTATTGAGACAGGGTCCCATGTGTANTCCTGGCTGGNTTGGAACTTCACATGTAN
ANCANGCGGNCTTGAGTTTATGACTNTCCNTTCTNTGNNCTTGCTTTGTGNTGNTGGNGCTGNNCTGANCAGACCTTGGG
CATGCCNGAAAAGCTGTCCNCCACCCAGGTATCCNCNGCCNNNATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11385E12HMR1
Sequence
AANAAAATGTCNAGGGGCTGGAGAGATGGCTCAGTAGTTAAGAGCATTTGACTGCTCTCCCAGAGGTCCTGAGTTCAATA
CCCAGCACCCACATGGTGGCTCANAACCATCTGTCATGATTCCTTCTTTTGGTATGCATGAAGACAGAACACTCATAAAC
ATCAAATATATAAATACATGAATCTTGAGAGAGAGAGAAGAGAAGAGAAGAAAAAAAAGAAAAGAAAAGAAAAGAAAAGA
ANAGAANAGAAGGGAAAAGGTCTAGCCAGGCATGATGGTGTAGTTCCTTTAATCCTANACTTCAGGAGGCAGAAGCAAAC
AGATCTCTGACTTTTTTTCTTTCTTTCTTTCTTCTTCTTCTTCTTN
Sequence Type genomic DNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120706405..120706769 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es