Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11057F6
Clone ID IST11057F6
Vector VICTR76
Project tigm

Sequence tag IST11057F6BBF1
Sequence
AAAGAAAAGAAAGAAAAAAGGAAGAAAGAGGAGGAAGGAAGGAGAGAAAGAAAATAGCTCTCTTTGAAATTGTCTGCTTC
CAGCCTGGGAGGCGAAGATGAGACTTCTGGGAGCTTGAGTGCTTAAGTCCCTACAATTGCTCCTGAAAAGTGTTCTGTGT
CAGTTCTGGGTAGGTGCTGTTGGCACAGCTGGGGCCAGAGCACGAGTCCTCCCTTCGGACTATTTGTCATCAGATTCAGC
ATGAAGTACATCCAACGATCCCTGTCCCTTCTCTCAGTTGCTTCTGCCCGTCATGCTCAGGGTGCTGAGAGAGCCCTGGG
GGAGTGCGTCCAAGCCAACGTCTCACTGACACTCATTGAGGCTGAGGCCCTCCATTACCCCAGANCAACCACTAAATGAG
GAAGACTACTGCTCTTTCCTGTGATCAGATTGTTTCCCTCTAGTCCTTCCTGGCTTCGTCCCCGGGCAGTATNATTAAGC
CGTGCTGCAAGGTGTCTCANANCTGN
Sequence Type genomic DNA
Unitrap ID UNI31359

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108198025..108198529 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]


Sequence tag IST11057F6HMF1
Sequence
AAAGAAAAGAAAGAAAAAAGGAAGAAAGAGGAGGAAGGAAGGAGAGAAAGAAAATAGCTCTCTTTGAAATTGTCTGCTTC
CAGCCTGGGAGGCGAAGATGAGACTTCTGGGAGCTTGAGTGCTTAAGTCCCTACAATTGCTCCTGAAAAGTGTTCTGTGT
CAGTTCTGGGTAGGTGCTGTTGGCACAGCTGGGGCCAGAGCACGAGTCCTCCCTTCGGACTATTTGTCATCAGATTCAGC
ATGAAGTACATCCAACGATCCCTGTCCCTTCTCTCAGTTGCTTCTGCCCGTCATGCTCAGGGTGCTGAGAGAGCCCTGGG
GGAGTGCGTCCAAGCCAACGTCTCACTGACACTCATTGAGGCTGAGGCCCTCCATTACCCCAGANCAACCACTAAATGAG
GAAGACTACTGCTCTTTCCTGTGATCAGATTGTTTCCCTCTAGTCCTTCCTGGCTTCGTCCCCGGGCAGTATTATTAAGC
CGTGCTGCAAGGTGTCTCAGATCTGGAAAATTGGACACGANTATATGCNACAGTTTTCTGGGAAAGTCTGGN

Sequence Type genomic DNA
Unitrap ID UNI31359

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108198025..108198575 545
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]

 
Come back to gene ENSMUSG00000032606


For any suggestions or comments, please send an email to unitrap@crg.es