Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10740E5
Clone ID IST10740E5
Vector VICTR76
Project tigm

Sequence tag IST10740E5BBF1
Sequence
NNTNCTGTGGCTTANGCCGCCTCCCCTGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCNGCTGTCCCCGGCCC
ACACAN

Sequence Type genomic DNA
Unitrap ID UNI31733 UNI33857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 48603991..48604071 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 10695516..10695596 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019828 (Grm1) NM_016976 glutamate receptor, metabotropic 1 Gene [Source:MGI (curated);Acc:Grm1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13516632..13516712 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 38775377..38775457 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14855918..14855998 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 36088580..36088660 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 18244634..18244714 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 69209702..69209782 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 60923662..60923742 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 23148886..23148966 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073620 (AC131338.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12577670..12577750 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 44214878..44214958 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 28413513..28413593 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40544779..40544859 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 26707139..26707219 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 16341630..16341710 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 65356345..65356425 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15652601..15652681 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 16638656..16638736 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 21043938..21044018 77
NO GENE  


Sequence tag IST10740E5HMF2
Sequence
ACTAAATTCCTAAGTTCCTTGGANTCCCGGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCTGCCG
GGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCTCAN

Sequence Type genomic DNA
Unitrap ID UNI4014 UNI31381

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7324723..7324869 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57052700..57052846 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7827145..7827291 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14462479..14462625 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 84628995..84629141 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35521396..35521542 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22619832..22619978 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 70947058..70947204 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 82116047..82116193 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 60113429..60113575 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 27826426..27826572 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 99749227..99749373 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 28413500..28413646 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55880235..55880381 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 56650629..56650775 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7437314..7437460 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73686208..73686354 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 65553562..65553708 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054162 (Spock3) NM_023689 sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 Gene [Source:MGI (curated);Acc:Spock3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82369473..82369619 145
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 41032295..41032441 145
NO GENE  

 
Come back to gene ENSMUSG00000054162


For any suggestions or comments, please send an email to unitrap@crg.es