Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14980G3
Clone ID IST14980G3
Vector VICTR76
Project tigm

Sequence tag IST14980G3BBF1
Sequence
ATTTTAATGTGAGTTAATACGAATTGTGCTTANCTTCAAATGAATGAGACTCAAACTATGATTTATTTGTTAGGCTCTGT
CAGTTATGGGGGTGGGGAGGGTTACCCCTAGTCTAATTCNCTAACGCNGGTCTGACTACTACCTCANCTGTNCTCCNNNA
ATACTTGCTGTTGGGAATTTTCTGGGATATGTCTGCTTATGGGGTTCTGGGGAGGCATTTCACTCTGGCCCGTGTTGCTG
GCCCNTCATGACTAATANAGACCTCCGTTCNGTCTGCCTTCTCTCCTCCCTCCCTCATGGTGCCNACCANNCNCTTCCAN
CCCGGTNACNCNAACTCCACCTCCNTNTNTTGTCCCCCAATANTTGGCTGTTGACNNTTTTNTTTANCCNATANTTTTAT
TTTTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14980G3HMR1
Sequence
GCTTGCCTACTACAGCCCAGTGTTAGTTATGGAGGAACTTTCCAAGTTGAGGTTGCTTCCTTTCAGACAACTTTANCTTA
TATCAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165626621..165626709 87
NO GENE  


Sequence tag IST14980G3HMF1
Sequence
ATTTTAATGTGAGTTAATACGAATTGTGCTTAGCTTCAAATGAATGAGACTCAAACTATGATTTATTTGTTAGGCTCTGT
CAGTTATGGGGGTGGGGAGGGTTACCCCTAGTCTAATTCTCTAACGCTGGTCTGACTACTACCTCAGCTGTACTCCCCAA
ATACTTGCTGTTGGGAATTTTCTGGGATATGTCTGCTTATGGGGTTCTGGGGAGGCATTTCACTCTGGCCCGTGTTGCTG
GCCCATCATGACTAATANAGACCTCCGTTCTGTCTGCCTTCTCTCCTCCCTCCCTCATGGTGCCTACCANACNCTTCCAN
CCCGGTNACTCNAACTCNANNNNNNNCTATTGTCN
Sequence Type genomic DNA
Unitrap ID UNI32699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165626231..165626584 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es