Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14401D10
Clone ID IST14401D10
Vector VICTR74
Project tigm

Sequence tag IST14401D10HMF1
Sequence
GGTCAAGAAATAATGGAACCAAGACATGTTANTCTGCTCAAGGTTCAAATGTTTAATGGCGGACGTGCTTTATAAAGGAG
GGGGGAGGCCCATTCCCGCCAGTTCATCCTTGGAGCCCAGCTGCAGGTAACCNCGTGATGGATAGGGTCTAGTCTCCAGA
ATAGCTAGGTGCCTTCCCAGCAGGTACCANCGACAGTGGCTGAACAATATANTGATTTANGGAGGCANACTTCNCCCTAN
TGGCAGCNAAGTTGAGGTCTGGTTCANCCANCTTCAGGTTAGGGGGAAGGTTACNNNTTCCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14401D10BBF1
Sequence
GGTCAAGAAATAATGGAACCAAGACATGTTAGTCTGCTCAAGGTTCAAATGTTTAATGGCGGACGTGCTTTATAAAGGAG
GGGGGAGGCCCATTCCCGCCAGTTCATCCTTGGAGCCCAGCTGCAGGTAACCACGTGATGGATAGGGTCTAGTCTCCAGA
ATAGCTAGGTGCCTTCCCAGCAGGTACCAGCGACAGTGGCTGAACAATATAGTGATTTAGGGAGGCAGACTTCACCCTAN
TGGCAGCAAAGTTGAGGTCTGGTTCAGCCAGCTTCANGTTAGGGGGAAGGTTACAATTTCCTCCCTGTTATTAATATTTA
AAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100105610..100105939 326
NO GENE  


Sequence tag IST14401D10HMR1
Sequence
GACCCATTTTAGGGAGTATCCTTGGTGAAGGTGAT
Sequence Type genomic DNA
Unitrap ID UNI23753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30019186..30019220 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043557 (Mdga1) NM_001081160 MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]

 
Come back to gene ENSMUSG00000043557


For any suggestions or comments, please send an email to unitrap@crg.es