Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0427
Clone ID AG0427
Vector pGT0lxr
Project sanger

Sequence tag AG0427
Sequence
AACGTGGCTGACTACGCCGCCTCTGACCAGGTGGCTCTACCCCGGGAGCTGCTGTGCAAACTGCATGTCAACAGGGCAGC
CTGCTACTTCACCATGGGCCTGTATGAGAAGGCGCTGGAGGACAGTGAGAAGGCTTTGGGCCTGGATGGCGAGAGTATCC
GGGCACTGTTCCGCAAGGCGCGCGCCCTCAACGAGCTGGGGCGCCACAAAGAGGCCTATGAATGCAGCAGCCGGTGCTCC
CTCGCGCTTCCCCACGATGAAAATGTCACCCAGCTGGGCCAGGAGCTGGCTCAGAAGCTTGGACTGCGGGTACGGAAAGC
CTATAAGAGACCCCAG
Sequence Type mRNA
Unitrap ID UNI3277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81599516..81602938 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022390 (Zc3h7b) NM_001081016 zinc finger CCCH type containing 7B Gene [Source:MGI Symbol;Acc:MGI:1328310]

 
Come back to gene ENSMUSG00000022390


For any suggestions or comments, please send an email to unitrap@crg.es