Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST447796
Clone ID OST447796
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST447796
Sequence
TGAGAAAATAATGCAAAACTTCATGATGGAGTATGTCAGCGCTGCAAAGAAGTTCTTGAGTGGCNGTGTAAAGTACAGCA
AATACAAGCCACTTGTCAAAGCCTAAGAAGTGTGTTAAATGTTTACAAAAGACAGTAAAGGACTCTTACCACATAATGTG
TAANACCATGNNCCTGTGANCTTGAAGTTTNTGCCAAATGTGGAAAGAAAGAANAGATCGTTATTCCGTTTAATAAAGAN
CCAGACGCTCCAAAAAACACTGAAAATGAAGGTTCTGGCCATAGAANGNGCTGCGGACGGAAGGAAGACAGTGATGAGGA
CTTAGACGCTGAGTCTGACTNGNATGGCNAGGATGGAGACACTCANGCNTGACAACACCATGNCAATTGCNGAGGGAGTC
ANAANAGGCTNATGAGCAACATTGGTTATTTATAACATTTGAGTAACAGAATCTTAAAGGTTTTCACAGAAACACTT
Sequence Type mRNA
Unitrap ID UNI1364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21672575..21693707 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035171 (1110059E24Rik) NM_025423 RIKEN cDNA 1110059E24 gene Gene [Source:MGI Symbol;Acc:MGI:1913456]

 
Come back to gene ENSMUSG00000035171


For any suggestions or comments, please send an email to unitrap@crg.es