Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14842F11
Clone ID IST14842F11
Vector VICTR76
Project tigm

Sequence tag IST14842F11HMF1
Sequence
GCTTGAAGCCTTCNNGNNNNNNCTTTNATANTTGTGTAGCTTTNNNNCCATGCTGAGATGCAACCCAAAATCTCCCAGAA
AGCAGTGTATTTTAAACCTGCTCCTCTCTTCCTATGAAGTAACTGAATCGAGCTACATGCAAACAAGCTCTGCAGGAAGA
GACTTAGGTTGTCTCGGAAGGCAACCCAAGATGACCTGTTCCCTGTCCTAACGCCTGCCACAGTGACNGTCNCAANAGAA
TGTCCNGACNGCTTAAAACTTANGACGGGATAACACCCCATTCTGTACANGTTGTCNAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14842F11HMR1
Sequence
AAGCAAGCTCANCTCTCTTGCCCACTCTTGCTGCTTCAAAGGCGGGCGGACGGAAATGTANGGCATTGTTAATGGTCAGT
ATTCATCTGACTGAGTAAAACGTTAGCAAGACTCGAATGTTTTTCAAGTCAGTATCATCACGGGCAGGATTTATCTAAGC
AACAAGTGATTATTGAGCCATGGGAGTAGGGAGATGTGTCNGTGTCCGGAAACGGCCNCCCTTGGCTGTTCTGGGAGCTT
CTGCTCCATCANGTGNACNAGTGTANANCTTGNAN
Sequence Type genomic DNA
Unitrap ID UNI10776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73622316..73622587 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es