Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST447767
Clone ID OST447767
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST447767
Sequence
GGAGCTGCGAGGGACCTGAACCGGGCCGAGGAGTTCGCACAGAAATTCAACATCCCCAAGGCCTATGGCTCTTATGAGGA
ACTGGCCAAGGACCCAAACGTGGAGGTGGCCTACATCGCCACCCAGCACCCCCAGCACAAGCCAGCCGTACTCCTCTGCC
TGGCAGCAGGCAAGGCTGTCCTTTGTGAGAAACCCATGGGCGTGAATGCAGCAGAAGTTCGGGAGATGGTTGCCAAAGCC
CGTTTTCAAGGCGTCTTCCTTATGGAGG
Sequence Type mRNA
Unitrap ID UNI17188

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52742110..52743530 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011382 (Dhdh) NM_027903 dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI (curated);Acc:Dhdh-001]

 
Come back to gene ENSMUSG00000011382


For any suggestions or comments, please send an email to unitrap@crg.es