Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14616G3
Clone ID IST14616G3
Vector VICTR74
Project tigm

Sequence tag IST14616G3HMF2
Sequence
CTTTAATTAAAAAAAAAATGGCTGGGANTGANGGTGCNTGCCTTGAATCNNNNCANTGGGAAGGCNGGACAGGCANATNT
NTNANTNTGGANCCAGCCTGGTTTATNTACTAATTTCCNGGCTANCCAAGGCTACATANTGANATGCTGTCTGGAAAAAT
AAAAATGGAATTTTTGAAATAAAAGGAATGTCTGAAACCGATCCGTANCTGCCAGGGCTGGGCTCACAAAAACCCCTAAA
ATCCCTCTGCNGGAACCATGCNTGGTACGGGAGGGGGGTNCANCANTGTTGTAAGGTANGTTANTGGANANAGGCAACAC
CACANCCCANNNACNCTTGGGGAGGGGGGTGAGGCCNGGTGAAGGGCNTGGACAGAGGATNAANATGGTCNGGCGGCTGA
NCTCTAANNGAGGGACNTGAAACCCGGCCAGGCNGGCTAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14616G3BBF1
Sequence
CTTTAAGAGCAGCTGCGGAAAACACCCCCCTGCTCCGCTCCCGCNNNNNNCCCAGCCCCGCAGTTCCTCTTACCTGGGAG
GTTCCAGGTCCGCTGGACCGCGGTTCCCGCCGCTGCGCTGCTGATCCTGACTCCCCCGGCCCGTAGCAAAGGAACTGCTT
CTCAGGAGACTTTTCCAGGGCCAGAGAGCGCTAGGACGCGGAAACCAAAACGTAGCAAAACGATTGGTAGAAATTCTTGT
CACTCAGGCCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21982538..21982793 244
 
EST/CDNA Est Name
  NM_029281.1 - BC019219.1


Sequence tag IST14616G3HMR1
Sequence
AAAGACGCTGCTCTCACAATTCTGTTATGGATATCTTATGGTTGTCAGGAAGTTTGAGATCCTGTGAACTGGGATTGATC
ATGACTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI36165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21982443..21982541 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069743 (Zfp820) NP_083557 zinc finger protein 820 Gene [Source:MGI Symbol;Acc:MGI:1922674]

 
Come back to gene ENSMUSG00000069743


For any suggestions or comments, please send an email to unitrap@crg.es