Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14600C10
Clone ID IST14600C10
Vector VICTR74
Project tigm

Sequence tag IST14600C10HMF1
Sequence
CTACTAGCTGTACCCAATGGAAGCACCGCATCAGGAGGGCGGGACTTCCGTCAGAGACCATGGTGAGAGCCTGCGCGAAA
GACAACACTTCCTTTTGTGACTGGCGGTGAACGAGTGCGCAGTGCCATGAAGGCCTCGGGCACGGTAAGGAGGCCGCGGC
GGGGCAAAAGGTGCGGCGTTGGCGGCAGGGCCGCTCGGGTTGGCTGTGTCCTCCGGGGTGGTGGTGCNTNNNNCACGAGG
GTCCCTCANCGNNNAN
Sequence Type genomic DNA
Unitrap ID UNI11562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73421151..73421401 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045128 (Rpl18a) NM_029751 ribosomal protein L18A Gene [Source:MGI Symbol;Acc:MGI:1924058]

 
Come back to gene ENSMUSG00000045128


For any suggestions or comments, please send an email to unitrap@crg.es