Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14125H1
Clone ID IST14125H1
Vector VICTR74
Project tigm

Sequence tag IST14125H1HMR1
Sequence
TTCTGTTACACACACNTGANACTTTTCTGTGTGTGTGACAAATTTTGTTCAGTTTGTTAATTTAATTATGCTGGTATAAA
AATTAAACTTTATTGAATCCTATTTATTTAGTGAGTTTTTGTCATTTGGTACAACCCANCATTCCCAAGGTCTTTTTTTT
TTTTTNGGGTTTN
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60656636..60656807 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es