Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10077B9
Clone ID IST10077B9
Vector VICTR75
Project tigm

Sequence tag IST10077B9BBR1
Sequence
GGACTAAGCGATGGTGACTAAGTACTTCTTCTGTGGCTCCTCCTGGTGTGAGTGTTTTGGTGTGTAACAGAGCCGCAGGC
AGGCTGAGCCCCAGGAGCCCATGGCACATACCATGCCTAACAGCCACACTTCGCTGCGGTCTCTCCCTCTCACCCATGCT
CCTACTTCTCTACAGTTTAGCTGGAGCCTTGACCTCCCCCACCACACACATCCTGGATCCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26408826..26409046 205
NO GENE  


Sequence tag IST10077B9BBF1
Sequence
GTCCCTTCTCCATCCTTACTTGAGGGCTGTCTGGGGTGAGGGATGGAGAGGATGGGCTAGCCTTCCAACACACAGGTAGC
TCTGCCTAGGGGCAAAAGCCACGTGCTAGGTCAGTGTGTGCTGCGTGGCAGAGAGCAGATAAGGCGCTCACGGTGCCTAG
CGTGGGACTGTCCCTGCCACAGTCCCCTGCAGCCTTCTCATCTCCTGGACAGGCTCCAGGCTAGACAAATTATGACTGCA
TACTGAGAGTTTTGCTTTATTCATTTGGCTTCTAACAGGGGGTTGTAAAAAAAGAACTAGATGCCACTGCCTAGAGAACT
ACTTATCCCAGTAGAGTAGCCACCCCTTGCCACATTCAGAAACTGTCAAGACGATGAAAGCCACTTCCTGAGTCTCCGTT
GAACAATAGTTTTCTTGTGGGGGCCTGGAGCCCTGTGAGCCATCCTGTGGGTCATGACCTGTGGATGATGGACACTTATT
CCATCCAGCCTCAAGTTCCCCAACCATCTAAGGCATATGCACAATTTACAGGTGCAAGAGGGAGGAAGAGTTCAGGGGAT
G
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26409043..26409604 545
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es