Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13668F5
Clone ID IST13668F5
Vector VICTR74
Project tigm

Sequence tag IST13668F5HMF1
Sequence
ATGTGCATTGGTGTTTTGCCTGCATATATATTTTATGTTACACACACAAACACACAGGTCAGAGGTCACAGCTTGTGGAG
TANACTCTGTCTACTGTGTTTGAGAAGAGATTAACAGGAGGAAAGGAAGCAGCANTTAGAGCAGAAACAGTACATTTCAG
ANGATGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87342119..87342288 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es