Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13599D5
Clone ID IST13599D5
Vector VICTR74
Project tigm

Sequence tag IST13599D5BBF1
Sequence
TAAACAGTGTTCCATGGCCTCTGCTTGAGTTCACACCTTCCTTCAGGTTCTTGCCCTACCTGAATTCCTTCCCTGGCTTT
CCGAAGTGATCTACTGTGATTAGGACAGGTTAAGTCAAACAAACCCTTGCTTGCCCTANCTGCTTTTGGTCATGCATTTA
TCANACNNCANAAAGCAAACTAGGACAAAAGCCAAATGTGAAAATTANCANCNTATGANNTATTNGGAGCTGAATGCNTT
TT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13599D5HMR1
Sequence
ACATTGCTTACTGTCCATAGGCTACTGATTTTGCTTTTCTAAACAACCCAAAACCATCTGCTCAGGGGTGGCACCACCCA
CCATGGGCTAGACCCTCCCACATCAGTCATTATCAAGAAAATGCCTCTACTTGCCCAGACATGCCCAGAGGGCAAGCTGT
TGAAGGCGTTTTCCCATAAAGGTTCTCTCTTCCTATATAACTCTAGTATCAGATTGACAAAAGACTAACTAGCATAGCTT
TTTAAAGATTTGTATTCTTGAGAGTTTCATACATGTGCAGTGAAATATATTTACTACTAATAAACCTCCCTCCAACACCC
CCATATTCCTCTCAGTACAGTCCCCTAATTTCATGCATGCACACACACACCCCATCTAGTTGGGGCTACCTTTCTGTGCA
TGGGTGTTGGACCATCCACTGGAGTGTGGAAAATTGTTCCANTANCCNCANCNNNCANATTTNNNATGTAATTTNCNTNN
NTNNANCN
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003891..97004363 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]


Sequence tag IST13599D5HMF1
Sequence
TAAACAGTGTTCCATGGCCTCTGCTTGAGTTCACACCTTCCTTCAGGTTCTTGCCCTACCTGAATTCCTTCCCTGGCTTT
CCGAAGTGATCTACTGTGATTAGGACAGGTTAAGTCAAACAAACCCTTGCTTGCCCTANCTGCTTTTGGTCATGCATTTA
TCATACNNCNNAANGCNAACTANGACNAAAGCCAAATGTGAAAATTANCAACNTANGAGGTNTTTGGAGCTNAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es