Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12071F3
Clone ID IST12071F3
Vector VICTR76
Project tigm

Sequence tag IST12071F3BBF2
Sequence
AATTCACTGGGTTTAGTTGGATTCCGAGGTAACAAGGGCCAGGTGGCAGCATTGAATCGCCCGAGACAAGGTGATTCTAG
TTATTATAATGGACAGCGTANACAAAAGAATGTTTATAATAACATACCCAGTAATGGTCAGCACAGGAGAGGTGAAATTT
ATAATGGCATGACTCGGTTGGACCTTTGGTACTGGCTAACCAATCATGGTGTTTCCAGGAATGAAATACATAGGAAGCCT
ACTGCATATTTGTTTGATCTGTATAANCANAAAAATTCTCAAACAAATGAAAGAAAGGCTACATTAGATCGTGGTAAACA
GCCNAATGAAAGAAAGGCTACATTAGATCGTGGTAAACAGCAATCTCGGCCAGTGAATCAATTTCCAGACTTGAGACAGT
TTGCAGATCCNGAANNNNTTGAATGAAGGGGTGGCCAGGTTCCGCTGANGAANGATCTTGATAAGACACTCAAAGGTTTT
TGCTGTTACCCTTTCTCCNGTTCTTCCCCAGANGGACCTACGGCCTTTTACNNNGNTAACTGNACNCTGGGGAAAAGGAA
ATAATN
Sequence Type genomic DNA
Unitrap ID UNI31001 UNI31002 UNI34182 UNI34183 UNI35271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10881541..10882104 523
 
EST/CDNA Est Name
  NM_010643.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76643450..76644013 523
 
EST/CDNA Est Name
  NM_010643.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72179961..72180524 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048118 (Arid4a) NM_001081195 AT rich interactive domain 4A (RBP1-like) Gene [Source:MGI (curated);Acc:Arid4a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6711420..6711983 523
 
EST/CDNA Est Name
  NM_010643.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 43784930..43785493 523
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 97304167..97304730 523
 
EST/CDNA Est Name
  NM_010643.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 46979763..46980326 523
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23826983..23827546 523
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 33861127..33861690 523
 
EST/CDNA Est Name
  BG975984.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44294820..44295383 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025202 (Scd3) NM_024450 stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 158113836..158114399 523
 
EST/CDNA Est Name
  NM_010643.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 148377538..148378101 523
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116216972..116217535 523
 
EST/CDNA Est Name
  NM_010643.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67430670..67431233 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037736 (Limch1) NM_001001980 LIM and calponin homology domains 1 Gene [Source:MGI (curated);Acc:Limch1-013]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61730619..61731182 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079548 (AC125119.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51413213..51413776 523
 
EST/CDNA Est Name
  NM_010643.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 89204680..89205243 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047866 (Lonp2) NM_025827 lon peptidase 2, peroxisomal Gene [Source:MGI (curated);Acc:Lonp2-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67048254..67048817 523
 
EST/CDNA Est Name
  NM_010643.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17883729..17884292 523
NO GENE  


Sequence tag IST12071F3HMF1
Sequence
AATTCACTGGGTTTAGTTGGATTCCGAGGTAACAAGGGCCAGGTGGCANCNTTGAATCNCCCGANACAAGGTGATTCTAG
TTATTATAATGGACAGCGTAGACAAAAGAATGTTTATAATAACATACCCAGTAATGGTCAGCACAGGAGAGGTGAAATTT
ATAATGGCATGACTCGGTTGGACCTTTGGTACTGGCTAACCAATCATGGTGTTTCCAGGAATGAAATACATAGGAAGCCT
ACTGCATATTTGTTTGATCTGTATAAGCAGAAAAATTCTCAAACAAATGAAAGAAAGGCTACATTAGATCGTGGTAAACA
GCCNAATGAAAGAAAGGCTACATTAGNTCGTGGTAAACAGCAATCTCGGCNNGTGAATCNATTTCCAGACTTGANNCAGT
TTGCAGATCCNGAACCCCTTGAATGAANGGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI10157 UNI31001 UNI31002 UNI34182 UNI34183 UNI35271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10881541..10881974 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6153184..6153617 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72141863..72142296 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72179961..72180394 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048118 (Arid4a) NM_001081195 AT rich interactive domain 4A (RBP1-like) Gene [Source:MGI (curated);Acc:Arid4a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6711420..6711853 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8902031..8902464 408
 
EST/CDNA Est Name
  BY125477.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 97304167..97304600 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 41354116..41354549 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23827113..23827546 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 33861257..33861690 408
 
EST/CDNA Est Name
  BG975984.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44294820..44295253 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025202 (Scd3) NM_024450 stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152090923..152091356 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35607775..35608208 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 20867785..20868218 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67430670..67431103 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037736 (Limch1) NM_001001980 LIM and calponin homology domains 1 Gene [Source:MGI (curated);Acc:Limch1-013]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61730619..61731052 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079548 (AC125119.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51413213..51413646 408
 
EST/CDNA Est Name
  BF454440.1 - BF454644.1 - BF454568.1 - BF659323.1 - AW226734.1 - BF302208.1 - BG873141.1 - BF536542.1 - AI226613.1 - BM171833.1 - AA108812.1 - BF535295.1 - AA816190.1 - CV677049.1 - AW475233.1 - AA062294.1 - AW259251.1 - BF300402.1 - BF659214.1 - AW475372
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 89204680..89205113 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047866 (Lonp2) NM_025827 lon peptidase 2, peroxisomal Gene [Source:MGI (curated);Acc:Lonp2-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67048254..67048687 408
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 48921664..48922097 408
NO GENE  

 
Come back to gene ENSMUSG00000047866


For any suggestions or comments, please send an email to unitrap@crg.es