Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12026G10
Clone ID IST12026G10
Vector VICTR76
Project tigm

Sequence tag IST12026G10BBF1
Sequence
AACCCGAAGGCCCTGAAAAGCTATCCATTGGCCCTGCTGGCCTCCCTCCAGCNAGGTAGTGCTGGGGTTTTTTTTTGTTG
TTGTTTTGTTTCNTTTTTTTTAANTGTATTTATTATATGTNTGTGAATACACTGTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12026G10HMF2
Sequence
TTTCTACTAGCTGTAAGGCCAGCAATCCTTCTGAGGTTAGGGATCTAGGGGAANNGNGGGATGTGCTCTGAATTAACTTT
GCTAGGTAATTTAGAATATAGGAATCTCTAACATTGGACTGAATATTAGACCAGTCTGAGATTGANTTAGAATGGCTGGT
CACACTGAAGAAAGGAGAAAAATCATTATGACTCTATTAAATGACTAATTTTACTAAGTCTGAATATACAGTCTCTGATG
TACTATTGCCATAAAGTTAAAAGGCTAGAAGCTAGTCTAAACTGGAAAAATGACAAGTAAGGATGGATCTAAAACATGAA
TTTAATTTAGTTTTTTAGTCNATACAATCAGGACATGAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI30626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10808938..10809301 354
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29591700..29592063 354
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 81750968..81751331 354
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 77223788..77224151 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028399 (Ptprd) NM_001014288 protein tyrosine phosphatase, receptor type, D Gene [Source:MGI (curated);Acc:Ptprd-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 108034356..108034719 354
NO GENE  

 
Come back to gene ENSMUSG00000028399


For any suggestions or comments, please send an email to unitrap@crg.es