Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13951A4
Clone ID IST13951A4
Vector VICTR74
Project tigm

Sequence tag IST13951A4BBF1
Sequence
GGCGCACCCTCTCACCTGTTCAGACTAATTTCCTAAGTTCGGCGGGTCCCGGACCAAGATGGNNACCGCTGCTGCTGTGG
CTTANGTCNCCTCCCCANCCNGNCGGGCACCTGTCCTCNGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGTG
CTGCCTCANCGCCTCTGTGCTTCCGCCTGTTCCAGAAGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTGTTCAGACTAA
TTTCCTAAGTTCGGCGGGTCCCGGACCANNANNGNNACCNCNGCNNCNNTNGNTTANGN
Sequence Type genomic DNA
Unitrap ID UNI32928 UNI34022

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 100263233..100263500 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29936065..29936332 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78512001..78512268 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021065 (Fut8) NM_016893 fucosyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:1858901]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 29347292..29347559 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 112832030..112832297 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55515522..55515789 250
 
EST/CDNA Est Name
  BX512183.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84942403..84942670 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27620946..27621213 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 46984516..46984783 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33667266..33667533 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 105298102..105298369 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 26705966..26706233 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 23461283..23461550 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017978 (Cadps2) NM_153163 Ca2+-dependent activator protein for secretion 2 Gene [Source:MGI (curated);Acc:Cadps2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 64629136..64629403 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 115007534..115007801 250
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71819399..71819666 250
 
EST/CDNA Est Name
  BU706463.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 54857976..54858243 250
NO GENE  

 
Come back to gene BU706463.1


For any suggestions or comments, please send an email to unitrap@crg.es