Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10665B4
Clone ID IST10665B4
Vector VICTR76
Project tigm

Sequence tag IST10665B4BBF1
Sequence
CATCCACTTACTTACTTTGATATCTTTTGGTTTTTACTAAGTGTATACATACCAGGAGGGTGGGGAACTGGTTCATAGGC
CACCTTGGGATCATTTCTTTTTCTTTTTGTTTTTTCTGCCTCAGCCTCTTGAATGCAGGGATTATAGGCTAGCGACATGA
TATTTGTCTAAATGTCATTTATTCATTTTANTTTATTTACTTTTCTAAAGACAGGGTCTCAGTCTGCAGGGTCCCAGGGT
AACCTCANACTCTTGNCNNCTGTTTATGCCAATCTCCTGAGTTTTGGGATTTCANCCNAAATGTCCCTTATAACAAACCA
NACCAGGTTATGGGGATTCANCTCAGTTGACAGGAGTGCTTGGCTACTGTGGAAACCCTGATTTGATCTCTAGCACTACT
TAAACCCACTGANGCTGTGTACACCTNTACN
Sequence Type genomic DNA
Unitrap ID UNI11841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3167789..3168218 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]

 
Come back to gene ENSMUSG00000054753


For any suggestions or comments, please send an email to unitrap@crg.es