Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14945F5
Clone ID IST14945F5
Vector VICTR76
Project tigm

Sequence tag IST14945F5BBF1
Sequence
CCTACANTTCAACANANAACCGCTCACATCCTGCATCCNTGTCACACTTGCCAACCAGGGCCTTGTCAACCTCACCTAAN
CCAGTGGCCCGTGCGAAGTGGGAAACTCAATTGGGAAAATGTCCCCACCAGACTGGCCTGTGGGTAAGCGTGTGGGGACG
TTTTCTTAACTAATGATTATGTGGAGGGCCAGTCCATTGTAGGGGATACCACCCCTGGCAAAGCAGCCCTGGACGGTATA
AAAGAGCAGGCTGAACAANCTGTGGAAAGTGANCCAGAAAGTATCNGTCCTGCNCGGCCTCTTTTTGTTTCTGCTTCCNN
TCACTGGTCTGACTTCCTTCNGTGATGGANANNTNTAACCTGANNCANNTCCTTTCTTTCCCANGGCGCTTNNGGTCANG
TNGNNNTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14945F5HMF1
Sequence
CCTACAGTTCAACATAAAACCGCTCACATCCTGCATCCCTGTCACACTTGCCAACCAGGGCCTTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35139501..35139570 70
NO GENE  


Sequence tag IST14945F5HMR1
Sequence
TAGGGAAGANTGGGGAGAGATGACAGTTGCTGGGAGGAGTCAGANGAGGCTTGAAGTTGAAGGAGAGGCAGGGAGAGGAC
AGATGACACACCAGATTGTTTCTGTGAGTCCTTCCAGGGTAGACCTGTGTCTGCCTTAACTGAAAGCTCTGCCCCTGCAG
GGTAGGGAGTGCATGGTGGCTGCCTANTGTCACTTCANTGGGGGAATGAAGGAACAGTGCAGATGGTGACTGGCTTCTTC
ATATCTGGATGGACTAACAGAGAGCCTCATTCCTGCGGGGTANTACTTCNGACCTGCGCTCATTTGTGGTTTTCCTGGGT
GAAATCTATTGATGCCCANACCTGGCANTCTTGTTTCATANANTCCTTTANCTTTANAGCCNGATATGTTTCCNTGNACT
CANANNNTN
Sequence Type genomic DNA
Unitrap ID UNI20174

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35139567..35139968 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es