Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14771A2
Clone ID IST14771A2
Vector VICTR76
Project tigm

Sequence tag IST14771A2HMR1
Sequence
CGTCTTTCCTGTGCCTCGGCTTTCCTAAGTGCGTTGTACAGCTTGCTACAGTTTTACTTAGCTCACACCATCACTGTATG
AAGGAAACACTGGCATTCCCATTTCATTGGTAAAAAGGTTTTGTTTCTGAAACTACAGAACTAGTGTGAGCTCCCTAGAA
GCACGAGGTGAAGGCACTTGTTTAAAAGAGAATCNNNANCTTANGGAAGAGAGGGAGGGGCTTGAAAGAGGCAGCCCACG
CCCAAGCAACAGTAGGAGGGCCTTANTCTGTANTGCGCANGCTTGGAGAGGATTGAGGGANAGCTTGANAACACCTTTTG
AAGAAAACAACGTGGACGTGGCTAGGAAGGTTAGAGAACGAGGAGGCTTTGTAAAGAGTGNGAAAATTTTAAAGGGTANT
GGTTGCAGCTCGGTGGTGNNNGTGNCN
Sequence Type genomic DNA
Unitrap ID UNI513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4964742..4965159 394
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]


Sequence tag IST14771A2HMF2
Sequence
GACGTAACTGAGCAGTTTGACCAAGTTCCTCTTAGTTTCTTTATTCTCATATGCTTCTTAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4965156..4965221 66
NO GENE  

 
Come back to gene ENSMUSG00000061374


For any suggestions or comments, please send an email to unitrap@crg.es