Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12644F3
Clone ID IST12644F3
Vector VICTR76
Project tigm

Sequence tag IST12644F3HMF1
Sequence
ACTTAGTTCTAAAACAGTTGCTTTAACCCTGAGAGTCAGCCACACTGCACAGTGGTAACTCCTTAGTGATTTGTCCTTCT
CGTTTTATCTATCCCGCCCACACACANACCTTTACCTAATTCNNTNTTGCTTTANGTGCTCTTTAANTCNNCCATNTNCN
GTANCNNTGCAATTTTGTNANTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12644F3BBF1
Sequence
ATGACCNAGCATTCAAATACATGTGCTGTGGAGGACATTGTTATCCCACTACCATATGATGCTTANCTGTTTTTATATTT
ATTTCANATTTATTACATTTTATTTACTGGTTGCAGGGGGCATAGGTGTGCCTCAGCATGCATATGGAGGTCATAGGACA
ACCTGCAGGAATCTGTTCCCTCCTGTCCCCTGANACACTATCACATGTATCCCTGGTGTGTCTGGAACTTANNANATCTG
T
Sequence Type genomic DNA
Unitrap ID UNI35361

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27179820..27180059 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es