Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12873G12
Clone ID IST12873G12
Vector VICTR76
Project tigm

Sequence tag IST12873G12BBF2
Sequence
TCCCAAGGCACACAATGCCTGGGGCTCCCAACTGCATTTTAACTTGAAAAATACAAAAAAATGAGATCAAACCCCAAAGC
CCCGCTAGCTCTAGATACCACCACGCTTTTGGAGAAGTGTATAAATTGAGAAGTGAAAGACTTGGTGGTCTCTTTGTACG
CCTTTAACAAGTGTTCCTGGGCAGATGGAGCCACTTCCTCTCACCTTCTCAGAACCAGAGGGCAAGAGCCCAGGGCATGT
GTCATCTCCAGCCGTGTAGTGCCTCCATTCTGCCCCACAGATGTGTCTGCACAGGGGAAGGTCAGANCTCGGACGTCCAC
CCTCTAGCCAGCTTAGCAGACTCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6664342..6664691 348
NO GENE  


Sequence tag IST12873G12HMF1
Sequence
AACTGGGGATAGTTGGATTGTAACTCCTACTCCCTGAAGCCTTGCCTGAAGCGCCTACCTCAGATGAAAGACTATAGTCC
TGTGGAAGGCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI10340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58096889..58096982 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es