Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11942E5
Clone ID IST11942E5
Vector VICTR76
Project tigm

Sequence tag IST11942E5BBF1
Sequence
AGGAGGTCATAAATTCAAGACCAGCCTAGACTACNGATCAAACTCTATTTTGGGATGTGTGTGCAAGAATTTTGAAGAGC
TACCAGATACCTGACAACTCANAGTCTTCCATGATCACCAGCTGTAGTTATGTTGCCACAAAATTTTGTCNAAGACATCC
TCGTTCATTTTCTGAANCTGTAACTGANTACANGANATGGGATANTTGATGANTNNNGGAATCTNATTTTGANGGCACTG
GTCTTGANAGAANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11942E5HMF1
Sequence
AGGAGGTCATAANTTCAAGACCAGCCTANACTACAGATCAAACTCTATTTTGA
Sequence Type genomic DNA
Unitrap ID UNI21207

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90658297..90658348 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040812 (Agbl2) NP_848870 ATP/GTP binding protein-like 2 Gene [Source:MGI (curated);Acc:Agbl2-004]

 
Come back to gene ENSMUSG00000040812


For any suggestions or comments, please send an email to unitrap@crg.es