Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST447527
Clone ID OST447527
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST447527
Sequence
GGGAACAGCAGCGTGGGCAAGACATCCTTCCTGTTCCGCTATGCCGATGACTCCTTCACCCCTGCCTTCGTGAGCACAGT
GGGCATCAGACATTCAAGGTCAAGACGGTCTACCGACATGACAAGAGGATCAAGCTGCAGATTTGGGACACAGCAGGCCA
GGAGCGCTACCGGACAATCACCACGGCCTACTATCGCGGAGCTATGGGTTTCCTGCTCATGTATGACATCGCCAACCAGG
AGTCCTTCACCGCGGTGCAGGACTGGGCTACGCAGATCAAAACCTATTCCTGGGACAATGCCCAGGTAATCCTCGTGGGG
AACAAGTGTGACCTGGAAGACGAACGGGTCGTACCTGCTGAGGATGGCCGGAGGCTCGCCGATGATCTTGGTTAGTGCCC
AACCTNCTAGCTCCATACCCTGTCTTCACCCTTGAATCCCAGTCCCACAGG
Sequence Type mRNA
Unitrap ID UNI17211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21719029..21720292 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019066 (Rab3d) NM_031874 RAB3D, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab3d-002]

 
Come back to gene ENSMUSG00000019066


For any suggestions or comments, please send an email to unitrap@crg.es