Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12110F1
Clone ID IST12110F1
Vector VICTR76
Project tigm

Sequence tag IST12110F1BBF1
Sequence
GCCGGGAGGGTGGGTGGCTGCAGACTGATGCCAGCGCTCCTCAGCCCCTCTCACTGCAGACTGTCCGGGCACCTACCACA
CAATCTCGAACCGCCCCTCCCTACCCGTCCAGGTTCATGGAAGGGCCAGTTAGTTACACAAAGATGTGCAGGGCTGTGCA
CAACAGCGCGTGGGAGTGGGGATTATGCACAAGGGAAAAGGTGTGTGTTTTTTAAAATGAAAAAAGGAAGTANCACATGA
CTCATCCACACTGAAAATGCAAAGCCAAGCCAGACAGAAGAAAATACNATTANGAGAGAAAAATCCCCTANAGAACTGAA
AAGGANNCCTGCCTGCTAAATGTTCANTGAACCCCTGANCCTTGGANCGGCAGTCCACTTGTCTGAGCGCANTTTGAGGG
TTGGTGNCCNCCNNTCTGGGG
Sequence Type genomic DNA
Unitrap ID UNI29474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20442301..20442720 392
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es