Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11633E4
Clone ID IST11633E4
Vector VICTR76
Project tigm

Sequence tag IST11633E4HMR1
Sequence
CACTCTACCNCTGAAGTACATTCCCAATCATTCAATATACATGTATCGATTATGCTACCTGATATGTATATCATGTAAAT
ATATACATATATGAACTTAGGGTTGCAGTGACCTACTTTCCCAGGTTGTGAAGATTAGCAAAAAACGACGGAGAATGAGC
ACTCTTATGTATATAAATATAATTGCATTTTCCCCTTTTGAACTGTTGTTTTGATTTTTTTAAGATTCTTAATTGTGAAG
TATCTTCTTGTGTGAAAATGCAATTGAAGGATATGCTGTANAATTTCTATAATACCTGCTCCATANTAGTACAAGTGATG
GGTCC
Sequence Type genomic DNA
Unitrap ID UNI18641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138312588..138312911 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026404 (Ddx59) NM_026500 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI (curated);Acc:Ddx59-001]

 
Come back to gene ENSMUSG00000026404


For any suggestions or comments, please send an email to unitrap@crg.es