Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11623C9
Clone ID IST11623C9
Vector VICTR76
Project tigm

Sequence tag IST11623C9HMR1
Sequence
GGTAAGTTTCGGGGTGGCACACAAGTCACATTATCTTCTGACAGTATAGAGCCNCGTTGTGAGTGTTTGCTGGGTGACTT
CCTCTTTGCAACCGATGTCTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21976349..21976470 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]


Sequence tag IST11623C9HMF1
Sequence
CCAGGAAGCTGGCAATAAGTTTGCCAACTGTATACACTTCTGACCCAACTTTACCGAGGCTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21976286..21976350 65
NO GENE  

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es