Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13600G9
Clone ID IST13600G9
Vector VICTR74
Project tigm

Sequence tag IST13600G9HMR1
Sequence
CTGACATATGTCCCCAGCCCTCCATAGTGAGTTCCTAAGGATTATCCCTCAGAATGTGTGTCAGTCTAAGCTGAACAGTA
TCCAAAGGCATCTGCTGTTTTTAATTTGAAACTTTCATTTACTCATCCTAGTTCATCTTTCTACATGGTACCATGATCAA
ATACATTTTACTTTGTACTGAGAGACAGTGGCTCAGTAAACTAGTGAGCTAATAAATAAGTGGCTGGTGAAACAAGTTAC
TGTAGGCCAGGATTGAAAGTTATGTNANATTACTGC
Sequence Type genomic DNA
Unitrap ID UNI20037

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 39040690..39040964 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035236 (A930041I02Rik) NM_178778 RIKEN cDNA A930041I02 gene Gene [Source:MGI Symbol;Acc:MGI:2443716]

 
Come back to gene ENSMUSG00000035236


For any suggestions or comments, please send an email to unitrap@crg.es