Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14641H1
Clone ID IST14641H1
Vector VICTR74
Project tigm

Sequence tag IST14641H1HMR1
Sequence
ATTGTAGTTGAAATGCAGACATAATAAAAACACTCGATGGAATTACCCTCTAACTGCGCCTGTAAGCTGTAGTCTATGTT
TATAGTGTATACAAATACCATCTATACACAAATATGCCAAAGCAGCATGCTTCTTCCTAGACTCGTAGTTCATAAAAGTG
ATAGTTAATGCTTTTGTCCTCTCAGACTTTCTTTATAAGTAAGTTTATCAGAGAATGATTTCAGATGAAACCGAAGGAAA
ACAAGATCTTTTGAGATATACGTGTTTCTCAAAATTACTGCGAACATTTTAGAGGGACCCATCTTTTTGTGCCAAGTCCT
AATATGGTTC
Sequence Type genomic DNA
Unitrap ID UNI36179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77968194..77968522 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079454 (Ick) intestinal cell kinase Gene [Source:MGI (curated);Acc:Ick-003]


Sequence tag IST14641H1BBF1
Sequence
CAATCTATTACAGAATCAGGTATGAAAGTCATAAAAGTCCAATTGTGCGTGTCCCATTTTTGATCCACCTTGGATTTTGA
TATTTTGGTTAGAGAGAGTACTGTCAAGTACGTAACTGTAAATCTTCATCTTAGTTCTGGAAAACTGCATGTTTACTATG
TTTTCTTTTAAGTTTTAGATTTAATTACTTTATGCATATGACTGTTTCAACTGCNGGTATATGCATATGCNNGCTTGNTN
AANACCANANNANNNTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77967951..77968197 235
NO GENE  


Sequence tag IST14641H1HMF1
Sequence
CAATCTATTACAGAATCAGGTATGAAAGTCATAAAAGTCCAATTGTGCGTGTCCCATTTTTGATCCACCTTGGATTTTGA
TATTTTGGTTAGAGAGAGTACTGTCAAGTACGTAACTGTAAATCTTCATCTTAGTTCTGGAAAACTGCATGTTTACTATG
TTTTCTTTTAAGTTTTAGATTTAATTACTTTATGCATATGACTGTTTCAACTGCAGGTATATGCATATGCATGCTTGGTG
AAGACCAGAAGAGAGTTATTTTGTGTGCATGGATAGAGGCATTCCATGGAGTATGTTATGTGTAGAGGTCAGAGGATAAC
TGTAGGGAGTTGGTCTCTCCTTCTACTATGCAGATCCCAGGGAATCATATATTTCTTCNTCANATNNNNNNNANTNTATA
TGCATGANTGTTNTGCCTGCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77967778..77968197 394
 
EST/CDNA Est Name
  BE688436.1

 
Come back to gene BE688436.1


For any suggestions or comments, please send an email to unitrap@crg.es