Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11635G9
Clone ID IST11635G9
Vector VICTR76
Project tigm

Sequence tag IST11635G9HMR1
Sequence
GGTGCAGAGCATCAAACTCGGGGCGTCCTAGCCTCCTAGGCAAGCGCTCTANATTGTGACCTCAACTCGGCCCCTGCTAC
AGTTGTGCAGTGTTCGACAGTCTTATGTAGACAGAACTACCTTGCCTCAGTCTCCCGCTGACTGGGCTCACAGGCCTCCC
TGTGACCTTGGGGAAAATCAACCACGGATAGGTAATTTGTCTGGGTGGGCTGTCAAAGGAAAAGGTTTGATCTCGGCTTA
CGTCACTGCCTGTGGAAGCTGGTGGATTCATTTTANAGGGTTGTGCCCTGAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI6174

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79755961..79756256 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063457 (Rps15) NM_009091 ribosomal protein S15 Gene [Source:MGI (curated);Acc:Rps15-001]

 
Come back to gene ENSMUSG00000063457


For any suggestions or comments, please send an email to unitrap@crg.es