Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12262F1
Clone ID IST12262F1
Vector VICTR76
Project tigm

Sequence tag IST12262F1HMF2
Sequence
NNGATAGGTTTATTNNNNGNNNACNNNNGNNTNATACNTGAGGGAGAANAGGGTAAACNNNNNANNGANNNTTCCNAAGA
GTTNCNGTTGCTGCTCCCGGCTGANCCTNGNTNTGCTTTANAGTCCCGTGAGACTGGAAAGCTGCTGAAAACAGCGAACT
CATTTCAGGTGGGATATACNCANCCNAATANNCNCNTGATTCCGGCGGCCATTTTCTCGCACCCGGTCTGTCGCCATCTT
CCAGGAGGACAAACTATTGCCCCCTACCCTCATCTAATGCTGCCAGTGATTACTTTGGTAACAGACTAGAGAAGATACAT
CCTTAACCCTAGCCNGGAAGCCGCACAAAAGANTTCGTCTTACAAATAGCTTTTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12262F1BBF1
Sequence
CAAACACAAAAGGGAAANNNNNTGGGAAGTCTCCACTGGCTTGCTGACTGTTCAGTCCGTGCTGACACTGTCTTATTAGC
CCCCCCAACCACTAGGCAGAAAATCACAGCCTTCCCTGGAATGCCGCCTCCCACGCACTCCTTGTCACAGGGGGCACTGT
GCAGCCAGCTGTTTGTTTCTTGTCTTTTTTGTTGTGTTAGGAACTTTGTTTGTTGATGGATCTTTGAGACCACTTANAAC
AATGACTGGTCCACAGCTCANTAACTGCATTCTTATGAATTATTTAAGAGAATTCTCTCTTCATTATTTTTCCTTTTTCT
TTTTTCTCTTTTCTTCTTTCTTTCTGGCAGANTCTCTGTATGTGACCTTGGCTGTCCTGAATTGAACTATGTAGACCAGG
TTGGTTTTTAACTCATAGAGAACTACTTGCCTCTGGCTCCTAAATGCTTANATTANNGGTGTTTAANAANATGCCCAGCC
NGCCNNGCNGTGATGGCNCATGCCTTTAATCCTANCACNNNGGANNCN
Sequence Type genomic DNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84880535..84881052 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es