Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12045G8
Clone ID IST12045G8
Vector VICTR76
Project tigm

Sequence tag IST12045G8HMF1
Sequence
AGGCCAGCCTGGTCTGCAAAGTGAGTTCCAGGACAGTCAGGGCTATACAGAGAAACCCTGTCTTGAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI1946 UNI31659 UNI31660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 18731222..18731292 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 75358637..75358707 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62664389..62664459 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 113483691..113483761 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 110092182..110092252 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044749 (Abca6) NM_147218 ATP-binding cassette, sub-family A (ABC1), member 6 Gene [Source:MGI (curated);Acc:Abca6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4372547..4372617 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 71100293..71100363 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 126345383..126345453 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 153277502..153277572 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052544 (St6galnac3) NM_011372 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1341828]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22952230..22952300 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 78560356..78560426 69
NO GENE  


Sequence tag IST12045G8BBF1
Sequence
AGGCCAGCCTGGTCTGCAAAGTGAGTTCCAGGACAGTCAGGGCTATACAGAGAAACCCTGTCTTGAAAAANNNAANNAAA
Sequence Type genomic DNA
Unitrap ID UNI31113 UNI31660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 78560356..78560425 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4372547..4372616 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 91674322..91674391 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 38911121..38911190 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036095 (Dgkb) NM_178681 diacylglycerol kinase, beta Gene [Source:MGI Symbol;Acc:MGI:2442474]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62664389..62664458 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4011132..4011201 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 68792019..68792088 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 18731223..18731292 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22952230..22952299 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87682864..87682933 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 126345383..126345452 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 71100293..71100362 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 138055688..138055757 68
NO GENE  

 
Come back to gene ENSMUSG00000026781


For any suggestions or comments, please send an email to unitrap@crg.es