Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10210A4
Clone ID IST10210A4
Vector VICTR76
Project tigm

Sequence tag IST10210A4BBF1
Sequence
ACACAAAATGTGACTTAATATTTTTCTTGAACTAAAAAAANANCATTTAAAATTTGACTTTTCCTTTACTAGGGTCCTAA
ACAAGAAAATGTTCCTCCCCCTCCCCAACTTGANATTTCCATCATGTATTTTAAAATCATTATTTTTTGACCCAATCCCC
CCATGTTCTCTAATTTATTCCTGAACTTAAGACTTGCCTTGGAGTGTGGCTGACATATCAACTGATACTCTCCGGTGGGG
GGGGGGGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 118222921..118223168 242
 
EST/CDNA Est Name
  CD539679.1 - CN533001.1 - CN688137.1 - CF165074.1 - AW244554.1


Sequence tag IST10210A4HMF1
Sequence
CTCAGTCCTCCTGCTTCAGCTTCCTTCTCTTGAACTCAGTCCTCCTGCTTCAGCTTCCTTCTCTTGAACTCAGTCCTCCT
GCTTCAGCTTCCTTCTCTTGAACTCAGTCCTCCTGCTTCAGCTTCCCTCCAGGCCGGGGTCACCACATCTGGCTTTTCTC
TACTCTTAAGATTGCTCAGACTCTTTGTTTATTCTTTTTTCATTTTAAGGTAATGAGTGTATAGTGAACATAAATGTTTA
CTTAGTAGTTGTTCCACACCAGGGCTACAGATTGAACCCAGGACCTCCTACAGGCTAGCTAGGCANTTGCCCTATCAA
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84855979..84856295 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es