Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10189G11
Clone ID IST10189G11
Vector VICTR76
Project tigm

Sequence tag IST10189G11BBF1
Sequence
NAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCACTCAAAACACAGCGTTCCTCACAAGCTTTTGGC
AGTACAATAAATAAAACTTCAAGAAATGTCTTTACTTCGAATCACCTATTTGTCTCAGAGAAAATGAAGTATCTACTTTG
CTCGCATCGTGTTGAGAAGCCACAACCCAATTCCACAGAATCCCAAAACCTCACATCACTTAACAAAACAAAACCNAGTC
TCCTTAATTTCTGAGAAACGGCCGCCACAAAATAGGTCGCTCCCTTTCGTANGCGAGCCCTTCACGTCCGACAACCCANT
GGCTGCGCTAGGGGATTTCGGCCNTGGGTGGCTTGGGGCACGTGGCGGCNNGGGGATCNGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79805765..79806100 322
NO GENE  


Sequence tag IST10189G11HMF2
Sequence
TTTGCTACACAGTCTGATTGTGTTGTGAGCCACTGGAAAGAAAATGCTGTCCGTTTCTCTTAATCACAGTCC
Sequence Type genomic DNA
Unitrap ID UNI34221

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20776961..20777030 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019986 (Ahi1) NM_026203 Abelson helper integration site 1 Gene [Source:MGI Symbol;Acc:MGI:87971]

 
Come back to gene ENSMUSG00000019986


For any suggestions or comments, please send an email to unitrap@crg.es