Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST447455
Clone ID OST447455
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST447455
Sequence
GACTGAGAGTTCTACAGCCTCCAACACGAGNNCTGAAAGCCAGGCTGCGGTGGATGGACCAGGATGCTGCGGGTTGACCA
GACTGCTGCGGATGGACCAGGCTGCTGCGGGTGGACCAGGCTGCTGCGGGTGGACCAGGCTGCTGCGGGTGGACCAGGCT
GCTGCGGGTGGACCAGGCTGCTGCGGGTGGGCCTCGCTGCAGTTGCTGCGGATGGATCTGATGCCTGTTAAGCATCACTT
CTCCAGTGTGAGCCCGCCACCTCCATTTCCGTCACGTGTGCCCATCTTTTTCAGTCTAATGAACTCCAACCATCAGCGCA
ACTTAAGTTCGGCTGTCTGTTCGTGCATGCTTAATATTAAAAATGTACTAACAGTGTGGCTGAGAAATCAAATTATGCAC
ATAAATATGCTGGCATAGCAGAGGCGGCGGCAGAAGCTGAACTTAGCAGAGCTGACGCCAGTTCACATTTGCAAATCGCC
CGTCAATCTGTCATTAAACATGTTATCAAATGA
Sequence Type mRNA
Unitrap ID UNI17219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 169738139..169738593 435
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047907 (Tshz2) NP_536703 teashirt zinc finger family member 2 Gene [Source:MGI (curated);Acc:Tshz2-002]

 
Come back to gene ENSMUSG00000047907


For any suggestions or comments, please send an email to unitrap@crg.es