Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14673D1
Clone ID IST14673D1
Vector VICTR74
Project tigm

Sequence tag IST14673D1BBF1
Sequence
GCAACACTATTCACAGCAGCCAACAGCAGCCCAGCCAGCCAGAAAAACTGCCCAGCAATAAGAAGGAATGACATTGATGC
TGTTAACAACACAGCAATGGAAGCAGTTAGCGACAGCCACGTCCTAAGATCCCATGGCTGCGGGATGTGCCATGTCAGAG
CAGGCACATCTAGAGTCAGAGAAATGCAGTCAGAACCATTAGAGATGGTTGTGAGCCACCATGTGACTGCTGGGAATTGA
AATCAGGACCTCTGCAAGAGATTATAACTGCTGAGCCATTTCTCCAGCCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115514953..115515241 289
NO GENE  


Sequence tag IST14673D1HMR1
Sequence
TTGCTGCAAGTGCTTGTGGGCAGTCAGGGTTGATGTGAGTGTGTGTTCTCATGCCTCACGAGTAGTANAAATACTGGACG
ACTTGGTAATTCTTTGACTTAATGGTTTAAGAAAAGCCACGGGTTTCAAGGCGTCTATGCCACTTGGCCCGGCTGCTAGC
ATTGTAAGAGTTTGTCCATTCTCTCACCC
Sequence Type genomic DNA
Unitrap ID UNI15803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115515238..115515425 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]


Sequence tag IST14673D1HMF1
Sequence
GCAACACTATTCACAGCAGCCAACAGCAGCCCAGCCAGCCAGAAAAACTGCCCAGCAATAAGAAGGAATGACATTGATGC
TGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115515158..115515241 84
NO GENE  

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es