Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13410G12
Clone ID IST13410G12
Vector VICTR74
Project tigm

Sequence tag IST13410G12BBF1
Sequence
ATTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI7787 UNI9397 UNI13618 UNI31884 UNI32250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10877889..10877949 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41124652..41124712 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5650316..5650376 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8775177..8775237 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8493196..8493256 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14751583..14751643 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079357 (AC171681.1)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8056388..8056448 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 28778061..28778121 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15109908..15109968 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 31669875..31669935 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6290692..6290752 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024772 (Ehd1) NM_010119 EH-domain containing 1 Gene [Source:MGI (curated);Acc:Ehd1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29288908..29288968 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026799 (Med27) NM_026896 mediator complex subunit 27 Gene [Source:MGI (curated);Acc:Med27-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19909977..19910037 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 35028597..35028657 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33376288..33376348 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6741529..6741589 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3234162..3234222 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13131045..13131105 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031446 (Cul4a) NP_666319 cullin 4A Gene [Source:MGI (curated);Acc:Cul4a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50863756..50863816 61
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20630465..20630525 61
NO GENE  

 
Come back to gene ENSMUSG00000031446


For any suggestions or comments, please send an email to unitrap@crg.es