Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AF0008
Clone ID AF0008
Vector pGT0lxr
Project sanger

Sequence tag AF0008
Sequence
TTTTGAGCTTTTTTAGATGGTGGTTGTGAGCTTTTTTAGATGGTTTTTTTTTTACGACGGAGCCTAAGATATTCTTTGTC
TTGTCGGTACTAGAGTCACTGAAAGAGACATCCTATTATATGCACGTTCACAAGGACAATGGCGCCATTGTTCTTCGCGT
CTTCAAAGCAGCTACAAGAAGAAACCAAGATGGAGGGGAGCCCAAAGCATCTGAGAGAATTGATAAATGAAAGAAACATG
CTTAAAACATGACCGTTTTAAAGGTGAATGCTGACCAGTGAGATGCCAGCCTGCGTGTGAAGATCCTACAGCAGAAGTGC
AT
Sequence Type mRNA
Unitrap ID UNI1281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88416756..88417728 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032424 (2810026P18Rik) RIKEN cDNA 2810026P18 gene Gene [Source:MGI Symbol;Acc:MGI:1919905]

 
Come back to gene ENSMUSG00000032424


For any suggestions or comments, please send an email to unitrap@crg.es