Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14223C10
Clone ID IST14223C10
Vector VICTR74
Project tigm

Sequence tag IST14223C10BBF1
Sequence
CAAGGAACAGATTTGCTGTGGCAACCTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92508702..92508734 33
NO GENE  


Sequence tag IST14223C10HMF1
Sequence
CAAGGAACAGATTTGCTGTGGCAACCTTGGATCCCAGAACTGCAGTGATAGACCTAAGGCAACCCTAATGATAAGGGGTG
AGTGCTGAAGCACAAAAGCTAAACATGACCACCATTAAGAAATGATGTGCCGGGCTGGAGAGATGGCTCAGGGCTGGAGA
GATGGCTCAGAGGTTAAGAGCACTGACTGCTCTTCCAGAAATCCTGAGTTCAATTCCCAGCAACCACATGGTAGCTCACA
ACCACTTGTAATGGGATCCAATGCCCTCTTCTGATGTATCTGGAGACAGTAACAATGTACTCACATACATTAAATAAATA
AATAAATCTTTAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92508702..92509043 342
 
EST/CDNA Est Name
  DV054232.1 - BY244687.1 - BY250187.1 - CK624799.1 - BB852547.1 - CF174850.1 - BY257644.1 - CA538987.1 - CD565699.1 - CD544799.1 - DV658256.1 - CN705935.1 - CD563101.1 - CK620100.1 - CA539020.1 - CA540833.1 - BG081975.2 - CA559148.1 - CA555735.1 - CA559165


Sequence tag IST14223C10HMR1
Sequence
CTTGTCCTAAAAATGAGTGGATAGATAGTATTGTGGTCACTAAAGTCACTTTAAACAAAGACATTTGAGAGCTTTGGATA
TAGTTACAGTGTTAAAATGGAGCTGGCATTCTAAAGTGGGATCTAGTCTTTGGGTCAGTGAGAATGGGCCTTGGCCTAAG
AGTGAGCCCTGCAGAGGGAGC
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92508526..92508705 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es