Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10387E8
Clone ID IST10387E8
Vector VICTR76
Project tigm

Sequence tag IST10387E8HMF1
Sequence
TAAGTACACTGTAGCTGTCTTCANACACTCCAGAAGAGGGCGTCAGATCTCGTTACGGATGGTTGTGAGCCACCATGTGG
TTGCTGGGATTTGAACTTCGGACCTTCGGAAGAGTAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCCAAGG
CAATTTATAAACTAAAGTGTTAAACACTGGACTTGAAGTTTCGAGGAGTTAAGAGTCCATGATGGTGGAGCAAAGGCANA
CCTCCTGANAGCTCATACACTTGATGTGAGAGTGGGGAAGGAGGANCCTGCAGTANGGATGTAATANTCTTTGGAAGCCT
CANGGCCTGCCCATACCTCCTGATTCTTCCCAAAGAGTTTTACCAACTGGAAACCGCGAATCCCAACACATGAGCCTAAG
GGAGCCATTCTCATTCNAACCCTCACAGCTAGGTCATCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133211284..133211724 425
NO GENE  


Sequence tag IST10387E8BBF1
Sequence
TAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10464 UNI20768 UNI31432 UNI34190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4769550..4769599 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6107957..6108006 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4599245..4599294 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3544365..3544414 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3422725..3422774 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19200798..19200847 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 10409566..10409615 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4096701..4096750 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15077169..15077218 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6349499..6349548 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4709421..4709470 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5958057..5958106 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043241 (Upf2) NM_001081132 UPF2 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI (curated);Acc:Upf2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12384022..12384071 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3211844..3211893 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 14372448..14372497 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22348014..22348063 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3024145..3024194 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3020564..3020613 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3359221..3359270 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025899 (Alkbh8) NM_026303 alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 363597..363646 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072258 (Taf1a) NP_067441 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A Gene [Source:MGI Symbol;Acc:MGI:109578]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 9093044..9093093 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 575919..575968 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068457 (Uty) NM_009484 ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome Gene [Source:MGI Symbol;Acc:MGI:894810]

 
Come back to gene ENSMUSG00000068457


For any suggestions or comments, please send an email to unitrap@crg.es